Module Seq

Transcribes a DNA sequence into RNA.

If given a string, returns a new string object.

Given a Seq or MutableSeq, returns a new Seq object with an RNA alphabet.

Trying to transcribe a protein or RNA sequence raises an exception.

e.g. >>> transcribe("ACTGN") 'ACUGN'

Back-transcribes an RNA sequence into DNA.

If given a string, returns a new string object.

Given a Seq or MutableSeq, returns a new Seq object with an RNA alphabet.

Trying to transcribe a protein or DNA sequence raises an exception.

e.g. >>> back_transcribe("ACUGN") 'ACTGN'

Translate a nucleotide sequence into amino acids.

If given a string, returns a new string object.
Given a Seq or MutableSeq, returns a Seq object with a protein
alphabet.

table - Which codon table to use?  This can be either a name (string) or
        an NCBI identifier (integer).  Defaults to the "Standard" table.
stop_symbol - Single character string, what to use for terminators.
        This defaults to the asterisk, "*".
to_stop - Boolean, defaults to False meaning do a full translation
        continuing on past any stop codons (translated as the
        specified stop_symbol).  If True, translation is terminated
        at the first in frame stop codon (and the stop_symbol is
        not appended to the returned protein sequence).

A simple string example using the default (standard) genetic code,

>>> coding_dna = "GTGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"
>>> translate(coding_dna)
'VAIVMGR*KGAR*'
>>> translate(coding_dna, stop_symbol="@")
'VAIVMGR@KGAR@'
>>> translate(coding_dna, to_stop=True)
'VAIVMGR'
 
Now using NCBI table 2, where TGA is not a stop codon:

>>> translate(coding_dna, table=2)
'VAIVMGRWKGAR*'
>>> translate(coding_dna, table=2, to_stop=True)
'VAIVMGRWKGAR'

Note that if the sequence has no in-frame stop codon, then the to_stop
argument has no effect:

>>> coding_dna2 = "GTGGCCATTGTAATGGGCCGC"
>>> translate(coding_dna2)
'VAIVMGR'
>>> translate(coding_dna2, to_stop=True)
'VAIVMGR'

NOTE - Ambiguous codons like "TAN" or "NNN" could be an amino acid
or a stop codon.  These are translated as "X".  Any invalid codon
(e.g. "TA?" or "T-A") will throw a TranslationError.

NOTE - Does NOT support gapped sequences.

It will however translate either DNA or RNA.

Returns the reverse complement sequence of a nucleotide string.

If given a string, returns a new string object. Given a Seq or a MutableSeq, returns a new Seq object with the same alphabet.

Supports unambiguous and ambiguous nucleotide sequences.

e.g. >>> reverse_complement("ACTGN") 'NCAGT'